PubMed

Eur Urol Open Sci. 2024 Oct 15;70:21-27. doi: 10.1016/j.euros.2024.09.006. eCollection 2024 Dec.ABSTRACTNon-muscle-invasive bladder cancer (NMIBC) is a heterogeneous disease categorized as low, intermediate, high, or very high risk, for which recurrence and progression rates and thus management strategies differ. Current molecular subclassification of bladder cancer (BC) is mainly based on data for muscle-invasive disease, with very few data for NMIBC. A more accurate classification system is needed for better stratification of NMIBC using multiomics and immunohistopathological molecular data alongside clinical data collected in a prospective cohort. ProCaB (Prospective Sample Collection for Cancer of Bladder) is a single-center non-interventional, prospective study recruiting all eligible patients diagnosed with BC in a tertiary center in the Flanders region of Belgium. Clinical data have been collected in a prospective registry since August 2013. Biosamples (blood, urine, and BC tissue) are collected from each patient at diagnosis and are stored at -80°C at BioBank UZ Leuven after appropriate processing according to the protocol. Multiomics (genomics, epigenetics, transcriptomics, proteomics, lipidomics, metabolomics) and immunohistopathology analyses will be performed on appropriate samples. The target is to enroll 300 patients over a 5-yr period, and all patients will be followed for 5 yr. The objective is to create a biobank of samples from patients diagnosed with BC for use in multiomics and immunohistopathological analyses. Results from these analyses, together with long-term clinical data, can be used for comprehensive multilayered molecular characterization of disease recurrence and progression in intermediate- and (very) high-risk NMIBC, identification of multibiomarker panels for better stratification, and identification of a patient subgroup that does not respond to bacillus Calmette-Guérin treatment. This trial is registered on ClinicalTrials.gov as NCT04167332.PMID:39483518 | PMC:PMC11525467 | DOI:10.1016/j.euros.2024.09.006

Front Immunol. 2024 Oct 17;15:1427055. doi: 10.3389/fimmu.2024.1427055. eCollection 2024.ABSTRACTINTRODUCTION: Forkhead box P3 (Foxp3) T regulatory cells are critical for maintaining self-tolerance, immune homeostasis, and regulating the immune system.METHODS: We investigated interleukin-4 receptor alpha (IL-4Rα) signalling on T regulatory cells (Tregs) during Listeria monocytogenes (L. monocytogenes) infection using a mouse model on a BALB/c background, specifically with IL-4Rα knockdown in Tregs (Foxp3creIL-4Rα-/lox).RESULTS: We showed an impairment of Treg responses, along with a decreased bacterial burden and diminished tissue pathology in the liver and spleen, which translated into better survival. Mechanistically, we observed an enhancement of the Th1 signature, characterised by increased expression of the T-bet transcription factor and a greater number of effector T cells producing IFN-γ, IL-2 following ex-vivo stimulation with heat-killed L. monocytogenes in Foxp3creIL-4Rα-/lox mice. Furthermore, CD8 T cells from Foxp3creIL-4Rα-/lox mice displayed increased cytotoxicity (Granzyme-B) with higher proliferation capacity (Ki-67), better survival (Bcl-2) with concomitant reduced apoptosis (activated caspase 3). In contrast to L. monocytogenes, Foxp3creIL-4Rα-/lox mice displayed similar bacterial burdens, lung pathology and survival during Mycobacterium tuberculosis (M. tuberculosis) infection, despite increased T cell numbers and IFN-γ, TNF and IL-17 production.CONCLUSION: Our results demonstrated that the diminished IL-4Rα signalling on Foxp3+ T regulatory cells resulted in a loss of their functionality, leading to survival benefits in listeriosis but not in tuberculosis.PMID:39483462 | PMC:PMC11524857 | DOI:10.3389/fimmu.2024.1427055

Food Chem X. 2024 Oct 2;24:101872. doi: 10.1016/j.fochx.2024.101872. eCollection 2024 Dec 30.ABSTRACTFoodomics is an interdisciplinary field that integrates various omics technologies to explore the complex relationship between food and human health in depth. This approach offers valuable insights into the biochemical, molecular, and cellular composition of food by employing advanced omics techniques. Its applications span the food industry and human health, including efforts to combat malnutrition, provide dietary recommendations, and ensure food safety. This paper critically examines the successful applications of foodomics across areas such as food safety, quality, traceability, processing, and bioactivity. It highlights the crucial role of metabolomics, proteomics, and transcriptomics in achieving a comprehensive understanding of food components, their functions, and their interactions with human biology.PMID:39483356 | PMC:PMC11525469 | DOI:10.1016/j.fochx.2024.101872

Plant Cell Environ. 2024 Nov 1. doi: 10.1111/pce.15250. Online ahead of print.ABSTRACTSoybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.PMID:39483062 | DOI:10.1111/pce.15250

Avian Pathol. 2024 Nov 1:1-23. doi: 10.1080/03079457.2024.2423716. Online ahead of print.ABSTRACTCopper (Cu) is a necessary micro-element and plays important roles in many biochemical processes. However, excessive Cu intake can lead to multi-organ toxicity, especially in the spleen. To gain further insights into the specific mechanisms of splenic toxicity associated with Cu-induced metabolic disorders, 192 one-day-old chickens were selected and randomly divided into four groups for this study. The broilers were fed with diets containing Cu at final concentrations of 11, 110, 220 and 330 mg/kg for 49 days. The results showed that high Cu dietary caused nuclear shrinkage and mitochondrial vacuolization in spleen, and induced splenic injury through regulating the glutathione metabolism, pentose and gluconate interconversion, tryptophan metabolism and glycerophosphatidylcholine metabolism pathways. Moreover, excess Cu could disorder the mitochondrial dynamics via up-regulating the levels of Drp1, Parkin PINK1, and Dynein, and down-regulating the levels of Mfn1, Mfn2 and OPA1. Cu-treatment increased the levels of LC3A, LC3B, mTOR, Beclin1, ATG5, and decreased the p62 level to promote autophagy of splenocytes. Meanwhile, high dose of Cu promoted the splenocytes apoptosis by ascend the levels of p53, BAK-1, Bax, Cyt C and Caspase-3 and descend the level of Bcl-2. These results demonstrated that high dietary Cu could cause autophagy and apoptosis via inducing metabolic disturbances and disordering mitochondrial dynamics in spleen of broiler chicken.PMID:39483061 | DOI:10.1080/03079457.2024.2423716

Anim Biosci. 2024 Oct 28. doi: 10.5713/ab.24.0299. Online ahead of print.ABSTRACTOBJECTIVE: Animals will experience energy deprivation processes such as moulting, clutching, migration and long-distance transportation under natural survival conditions and in production practices, and the body will trigger a series of adaptive metabolic changes during these processes. Fasting and refeeding after fasting can induce remodeling of nutrients and energy metabolism. This study aims to investigate the mechanisms by which the gut microbiota and liver of poultry respond to energy deprivation under specific conditions.METHODS: Ninety 252-day-old laying hens were randomly divided into 3 groups: (1) fed ad libitum (control group); (2) fasted from day 13 to day 17 (fasting group); (3) fasted from day 1 to day 5, then refed on a specific feeding way (refeeding group). After that, the serum, liver, jejunum tissues, and cecum contents were sampled and sent for metabolome, transcriptome, morphology, and 16S rDNA sequencing analyses, respectively.RESULTS: Results showed that food deprivation not only observably decreased the body weight, liver index, and the villus height and villus/crypt ratio of jejunum, but also significantly changed the gut microbiota compositions, serum metabolic profiles, and the hepatic gene expression patterns of laying hens, whereas these changes were effectively reversed by the following refeeding operation. At the same time, metabolome combined transcriptome analysis revealed that both serum differential metabolites and hepatic differential expressed genes (DEGs) were consistently enriched in the lipid and amino metabolism pathways, and strong correlations were synchronously found between the differential metabolites and both of the differential gut microbial genera and DEGs, suggesting the crosstalks among gut, liver and their resulting serum metabolic products.CONCLUSION: The results suggested that the organism might coordinate to maintain metabolic homeostasis under energy deprivation through a combination of changes in gut microbial composition and hepatic gene expression.PMID:39483011 | DOI:10.5713/ab.24.0299

Anim Biosci. 2024 Oct 28. doi: 10.5713/ab.24.0435. Online ahead of print.ABSTRACTOBJECTIVE: Semen cryopreservation acts a crucial role in enhancing breed improvement and conserving genetic resources. However, it often leads to decreased sperm activity and reduced pregnancy rates. Despite significant advancements in semen freezing techniques for goats, the precise factors and mechanisms causing cryo-injury remain unclear.METHODS: In this study, we examined the motility characteristics of fresh semen versus frozen-thawed semen and investigated changes in the metabolite profiles of seminal plasma using liquid chromatograph-mass spectrometry (LC-MS).RESULTS: A total of 364 differentially expressed metabolites (DEMs) were identified between fresh and frozen-thawed semen samples. Among these, 185 metabolites were significantly up-regulated, while 179 were down-regulated (p<0.05). The majority of these DEMs belonged to lipids and lipid-like molecules, as well as organic acids and derivatives. The Kyoto Encyclopedia of Genes and Genomes (KEGG) indicated that these DEMs were primarily involved in pathways related to amino acid synthesis and metabolism. Additionally, metabolite set enrichment analysis (MSEA) underscored the critical role of amino acid synthesis and metabolic pathways in semen cryopreservation. Specific metabolites such as alanine, proline, phenylalanine, tryptophan, tyrosine, adenosine, citric acid, flavin adenine dinucleotide (FAD), and choline emerged as potential biomarkers for sperm cryo-injury in goats.CONCLUSION: These findings provide valuable insights into enhancing the quality of semen cryopreservation in goats, contributing to improved breeding and genetic resource conservation efforts.PMID:39483009 | DOI:10.5713/ab.24.0435

Anim Biosci. 2024 Oct 28. doi: 10.5713/ab.24.0564. Online ahead of print.ABSTRACTOBJECTIVE: Improving meat quality is important for commercial production and breeding. The molecular mechanism of intramuscular fat (IMF) deposition and meat characteristics remain further study.METHODS: This study aimed to study the mechanism of IMF deposition and meat characteristics including redox potential, nutrients compositions and volatile compounds in longissimus dorsi (LD) by comparing with different pig breeds including Shanghai white (SW), Duroc x (Landrace Yorkshire) (DLY) and Laiwu (LW) pigs.RESULTS: Results showed that the contents of IMF, triglyceride (TG), total cholesterol (TC), and redox potential parameters were lower, while the content of MDA and activity of lactate dehydrogenase (LDH) were higher in LD of SW pigs compared with LW pigs (p<0.05). No differences were observed about these parameters between SW and DLY pigs. Also, the contents of medium-long chain fatty acids and γ-aminobutyric acid (GABA) were higher, while Asp was lower in LD of SW pigs compared with LW pigs (p<0.05). Volatile compounds results showed that 6 ketones, 4 alkenes, 11 alkanes, 2 aldehydes, 1 alcohol were increased and cholesterol was decreased in SW pigs compared with LW pigs. Transcriptome results showed that differential expressed genes involved in lipid synthesis, metabolism and transport in LD between SW and LW pigs, which were further verified by qPCR. Spearman correlation showed that HSL and Nedd4 were positively related to contents of TG and IMF, while negatively related to volatile compounds and fatty acids (p<0.05). Plin3 and Mgll were negatively related to contents of TG, IMF and cholesterol, while positively related to MDA, LDH, and volatile compounds (p<0.05). PPARA was negatively related to contents of TC and IMF, and activity of SOD, while positively related to volatile compounds (p<0.05).CONCLUSION: Our study provided new insights into potential mechanisms of IMF deposition, nutrients composition and volatile compounds of muscular tissues of different pig breeds.PMID:39483008 | DOI:10.5713/ab.24.0564

Arthritis Res Ther. 2024 Nov 1;26(1):188. doi: 10.1186/s13075-024-03423-5.ABSTRACTOBJECTIVES: Patients with rheumatoid arthritis (RA) commonly experience a high prevalence of multiple metabolic diseases (MD), leading to higher morbidity and premature mortality. Here, we aimed to investigate the pathogenesis of MD in RA patients (RA_MD) through an integrated multi-omics approach.METHODS: Fecal and blood samples were collected from a total of 181 subjects in this study for multi-omics analyses, including 16S rRNA and internally transcribed spacer (ITS) gene sequencing, metabolomics, transcriptomics, proteomics and phosphoproteomics. Spearman's correlation and protein-protein interaction networks were used to assess the multi-omics data correlations. The Least Absolute Shrinkage and Selection Operator (LASSO) machine learning algorithm were used to identify disease-specific biomarkers for RA_MD diagnosis.RESULTS: Our results found that RA_MD was associated with differential abundance of gut microbiota such as Turicibacter and Neocosmospora, metabolites including decreased unsaturated fatty acid, genes related to linoleic acid metabolism and arachidonic acid metabolism, as well as downregulation of proteins and phosphoproteins involved in cholesterol metabolism. Furthermore, a multi-omics classifier differentiated RA_MD from RA with high accuracy (AUC: 0.958). Compared to gouty arthritis and systemic lupus erythematosus, dysregulation of lipid metabolism showed disease-specificity in RA_MD.CONCLUSIONS: The integration of multi-omics data demonstrates that lipid metabolic pathways play a crucial role in RA_MD, providing the basis and direction for the prevention and early diagnosis of MD, as well as new insights to complement clinical treatment options.PMID:39482717 | DOI:10.1186/s13075-024-03423-5

Mol Cancer. 2024 Oct 31;23(1):245. doi: 10.1186/s12943-024-02114-8.ABSTRACTBACKGROUND: Prostate cancer ranks as the second most frequently diagnosed cancer in men worldwide. Recent research highlights the crucial roles IL6ST-mediated signaling pathways play in the development and progression of various cancers, particularly through hyperactivated STAT3 signaling. However, the molecular programs mediated by IL6ST/STAT3 in prostate cancer are poorly understood.METHODS: To investigate the role of IL6ST signaling, we constitutively activated IL6ST signaling in the prostate epithelium of a Pten-deficient prostate cancer mouse model in vivo and examined IL6ST expression in large cohorts of prostate cancer patients. We complemented these data with in-depth transcriptomic and multiplex histopathological analyses.RESULTS: Genetic cell-autonomous activation of the IL6ST receptor in prostate epithelial cells triggers active STAT3 signaling and significantly reduces tumor growth in vivo. Mechanistically, genetic activation of IL6ST signaling mediates senescence via the STAT3/ARF/p53 axis and recruitment of cytotoxic T-cells, ultimately impeding tumor progression. In prostate cancer patients, high IL6ST mRNA expression levels correlate with better recurrence-free survival, increased senescence signals and a transition from an immune-cold to an immune-hot tumor.CONCLUSIONS: Our findings demonstrate a context-dependent role of IL6ST/STAT3 in carcinogenesis and a tumor-suppressive function in prostate cancer development by inducing senescence and immune cell attraction. We challenge the prevailing concept of blocking IL6ST/STAT3 signaling as a functional prostate cancer treatment and instead propose cell-autonomous IL6ST activation as a novel therapeutic strategy.PMID:39482716 | DOI:10.1186/s12943-024-02114-8

BMC Complement Med Ther. 2024 Oct 31;24(1):379. doi: 10.1186/s12906-024-04669-x.ABSTRACTBACKGROUND PISUM SATIVUM: (PS) is a universal legume plant utilized for both human and animal consumption, particularly its seeds, known as green peas. The processing of PS in food industries and households produces a significant amount of waste that needs to be valorized.METHODS: In this study, the metabolite profiles of the 70% ethanolic extracts of PS wastes, namely peels (PSP) and a combination of leaves and stems (PSLS), were investigated by liquid chromatography-electrospray ionization-quadrupole time-of-flight tandem mass spectrometry (LC-ESI-QTOF-MS/MS) followed by molecular networking.RESULTS: Different classes of metabolites were identified, being flavonoids and their derivatives, along with phenolic acids, the most abundant categories. Additionally, a comprehensive network pharmacology strategy was applied to elucidate potentially active metabolites, key targets, and the pathways involved in cytotoxic activity against breast cancer. This cytotoxic activity was investigated in MCF-7 and MCF-10a cell lines. Results revealed that PSLS extract exhibited a potent cytotoxic activity with a good selectivity index (IC50 = 17.67 and selectivity index of 3.51), compared to the reference drug doxorubicin (IC50 = 2.69 µg/mL and selectivity index of 5.28). Whereas PSP extract appeared to be less potent and selective (IC50 = 32.92 µg/mL and selectivity index of 1.62). A similar performance was also observed for several polyphenolics isolated from the PSLS extract, including methyl cis p-coumarate, trans p-coumaric acid, and liquiritigenin/ 7-methyl liquiritigenin mixture. Methyl cis p-coumarate showed the most potent cytotoxic activity against MCF-7 cell line and the highest selectivity (IC50 = 1.18 µg/mL (6.91 µM) and selectivity index of 27.42). The network pharmacology study revealed that the isolated compounds could interact with several breast cancer-associated protein targets including carbonic anhydrases 1, 2, 4, 9, and 12, as well as aldo-keto reductase family 1 member B1, adenosine A3 receptor, protein tyrosine phosphatase non-receptor type 1, and estrogen receptor 2.CONCLUSION: The uncovered therapeutic potential of PSLS and its metabolite constituents pave the way for an efficient and mindful PS waste valorization, calling for further in-vitro and in-vivo research.PMID:39482666 | DOI:10.1186/s12906-024-04669-x

Prenat Diagn. 2024 Oct 31. doi: 10.1002/pd.6693. Online ahead of print.ABSTRACTBACKGROUND: Down syndrome (DS) is a congenital disorder caused by the presence of an extra copy of all or part of chromosome 21. It is characterized by significant intellectual disability, distinct facial features, and growth and developmental challenges. The utilization of metabolomics to analyze specific metabolic markers in maternal amniotic fluid may provide innovative tools and screening methods for investigating the early pathophysiology of trisomy 21 at the functional level.METHODS: Amniotic fluid samples were obtained via amniocentesis from 57 pregnancies with DS and 55 control pregnancies between 173/7 and 240/7 weeks of gestation. The targeted metabolomics focused on 34 organic acids, 17 amino acids, and 5 acylcarnitine metabolites. The untargeted metabolomics analysis concentrated on lipid profiles and included 602 metabolites that met quality control standards. Principal Component Analysis, Orthogonal Partial Least Squares Discriminant Analysis (OPLS-DA), and false discovery rate (FDR) adjustments were applied. MetaboAnalystR 5.0 was used to perform the metabolic pathway analysis on the identified differential metabolites.RESULTS: Fifty differential metabolites, including L-glutamine, eight organic acids, and 41 lipids, were significantly altered in DS based on three criteria: VIP > 1 in the OPLS-DA model, FDR-adjusted p-value < 0.05, and |log2FC| > log2(1.5) from a volcano plot of all detected metabolites. An analysis of 212 differential metabolites, selected from both targeted and untargeted approaches (VIP > 1 in the OPLS-DA model and FDR-adjusted p-value < 0.05), revealed significant changes in nine metabolic pathways. Fourteen key metabolites were identified to establish a screening model for DS, achieving an area under the curve of 1.00.CONCLUSIONS: Our results underscore the potential of metabolomics approaches in identifying concise and reliable biomarker combinations that demonstrate promising screening performance in DS.PMID:39482571 | DOI:10.1002/pd.6693

Sci Rep. 2024 Oct 31;14(1):26215. doi: 10.1038/s41598-024-77645-7.ABSTRACTThe levels of fasting-state serum bile acids (BAs) in individuals with polycystic ovary syndrome (PCOS) differ from those of control subjects. However, there is a lack of research on the BAs profile in lean women with PCOS and whether these changes are linked to the host metabolism. Therefore, our objective was to investigate the synthesis and metabolism of serum BAs in lean women with PCOS and assess the correlation between BAs and clinical characteristics. This study employed a cross-sectional design of lean women with PCOS (n = 240) in comparison to a control group (n = 80) consisting of healthy lean women. The findings revealed significant increases in the levels of non-12-OH BAs and chenodeoxycholic acid (CDCA)% (both P < 0.05) in lean women with PCOS. Additionally, a positive correlation was observed between CDCA% and total testosterone (T) (r = 0.130, P = 0.044) and free androgen index (FAI) (r = 0.153, P = 0.019). Furthermore, a decreased ratio of cholic acid/chenodeoxycholic acid (CA/CDCA) (P < 0.001) was observed in lean women with PCOS, suggesting the depletion or downregulation of CYP8B1. Receiver operating characteristic curve analysis indicated that the combination of CDCA/CA and DHEAS could potentially be used as a characteristic factor for PCOS in lean women. It is possible that enzymatic modifications in the liver could play a role in regulating hyperandrogenism in this specific subgroup of lean women with PCOS.PMID:39482365 | DOI:10.1038/s41598-024-77645-7

Comp Biochem Physiol C Toxicol Pharmacol. 2024 Oct 29:110063. doi: 10.1016/j.cbpc.2024.110063. Online ahead of print.ABSTRACTOver the past decades, the concern about lead pollution in marine environments has increased due to its remarkable toxicity, even at low concentrations. Lead is one of the significant contaminants arising from human activities in Antarctica. However, its effects on polar photosynthetic organisms are poorly known. This work aims to evaluate the effects of two different environmental concentrations of lead (10 μg/L and 50 μg/L) on pigment content, antioxidant enzyme activities (catalase, superoxide dismutase, ascorbate peroxidase and glutathione-S-transferase), metabolome, thalli morphology and cell ultrastructure of the red seaweed Iridaea cordata (Turner) Bory from Terra Nova Bay (Ross Sea, Antarctica). The results highlighted that lead exposure decreased phycocyanin and phycoerythrin content, starting from 10 μg/L, while induced carotenoid accumulation at 50 μg/L. Catalase, ascorbate peroxidase, and superoxide dismutase activities generally increased after lead exposure and distinct biochemical features were identified in the control and treatment groups. Further lead-related effects on cell ultrastructure comprised floridean starch accumulation and plastoglobuli formation. Overall, our results suggested that the enhanced formation of reactive oxygen species in response to lead altered the photosynthetic pigment pattern, antioxidant defenses, metabolome and ultrastructure of I. cordata.PMID:39481772 | DOI:10.1016/j.cbpc.2024.110063

Int J Biol Macromol. 2024 Oct 29:137027. doi: 10.1016/j.ijbiomac.2024.137027. Online ahead of print.ABSTRACTVitreoscilla hemoglobin (VHb) can enhance the ability of recombinant strains to express heterologous proteins under low-oxygen conditions. However, its mechanism of action in the Pichia pastoris expression system remains unclear. In this study, three VHb construction strategies were designed to elucidate the mechanisms by which VHb promotes heterologous protein expression in P. pastoris. Notably, the co-expression pattern involving the sequential expression of the 102C300C gene followed by the Vgb gene significantly improved enzyme activity in the recombinant strain X33-102C300C-Vgb. The enzyme activity was 203.4 ± 0.57 U/mL at 180 h of fermentation in the 5-L system, which was 20.7 % higher than that of the starting strain X33-102C300C. Fluorescent labeling experiments revealed for the first time that a dual-transcription unit approach achieved superior VHb expression, indicating its potential for further development. Furthermore, transcriptomic and metabolomic analyses demonstrated that VHb enhances the growth of recombinant yeast colonies by improving respiration-related metabolism under low-oxygen conditions. This, in turn, alleviated the repression of the expression alcohol oxidase (AOX) at high methanol concentrations, resulting in increased alginate lyase activity. This study provides a theoretical foundation for improving the target protein expression in recombinant P. pastoris during high-density fermentation.PMID:39481700 | DOI:10.1016/j.ijbiomac.2024.137027

Biochem Pharmacol. 2024 Oct 29:116596. doi: 10.1016/j.bcp.2024.116596. Online ahead of print.ABSTRACTGut microbiota-mediated endobiotic and xenobiotic metabolism play crucial roles in disease progression, and drug therapy/toxicity. Our recent study suggested that gut microbiota-mediated xanthine metabolism is correlated with resistance to high-fat diet (HFD)-induced obesity. Here, we explored the role of host-gut microbial xanthine co-metabolism in the prevention and treatment of HFD-induced obesity by orally administration of Bifidobacterium longum, xanthine, and a xanthine oxidase inhibitor (topiroxostat). The findings indicate that xanthine exhibits a significantly protective effect against HFD-induced obesity. While B. longum, xanthine, and topiroxostat did not alleviate the dysbiosis of the weight and glucose metabolism of HFD-induced obesity (DIO) and obesity resistance (DIR) mice. 16S rRNA sequencing analyses revealed that treatments with B. longum significantly altered gut microbiota composition in HFD-fed and DIO mice. Microbial interaction network analysis revealed several Bacteroidetes species, such as Amulumruptor caecigallinarius and Muribaculum intestinale, as keystone taxa that were notably enriched by B. longum. Untargeted metabolomics analysis implied that xanthine might serve as a crucial molecule in regulating body weight, exerting a preventive effect on HFD-induced obesity. This study offers new perspectives on the influence of host-gut microbial xanthine co-metabolism on HFD-fed mice and emphasizes the promising role of xanthine in promoting weight loss.PMID:39481656 | DOI:10.1016/j.bcp.2024.116596

Eur J Pharmacol. 2024 Oct 29:177074. doi: 10.1016/j.ejphar.2024.177074. Online ahead of print.ABSTRACTINTRODUCTION: The rising prevalence and severe consequences of nonalcoholic fatty liver disease (NAFLD) have driven the quest for preventive medications. Complanatoside A (CA) is the marked flavonoid of Astragali complanati semen, a traditional Chinese herb that acts on the liver meridian and is widely used to treat liver problems. CA has been proven to have considerable lipid-lowering and liver-protective effects in vitro. However, the efficacy of CA in preventing NAFLD has yet to be shown in vivo.METHODS: First, the effectiveness of CA against NAFLD was assessed using a high-fat diet (HFD) mouse model. Second, the CA protective mechanism against NAFLD was investigated using a combined metabolomics and network pharmacology strategy. Differential metabolites were identified by metabolomics-based analyses, and metabolic pathway analysis was accomplished by MetaboAnalyst. Potential therapeutic targets were obtained through network pharmacology. Finally, key targets were identified via compound-target networks and validated by molecular docking and western blotting.RESULTS: CA prevented NAFLD mainly by reducing liver lipid accumulation in HFD mice. Metabolomics identified 22 potential biomarkers for CA treatment of NAFLD, primarily involving glycerophospholipid and arachidonic acid metabolism. Fifty-one potential targets were determined by network pharmacology. Co-analysis revealed that albumin, peroxisome proliferator-activated receptor-alpha, retinoid X receptor alpha, interleukin-6, and tumor necrosis factor alpha were key targets.CONCLUSION: This experiment revealed that CA has a preventive effect on NAFLD, primarily by regulating the peroxisome proliferator-activated receptor-alpha/retinoid X receptor alpha pathway. Furthermore, it provides evidence supporting the potential use of CA in the long-term prevention of NAFLD.PMID:39481627 | DOI:10.1016/j.ejphar.2024.177074

Fish Shellfish Immunol. 2024 Oct 29:109994. doi: 10.1016/j.fsi.2024.109994. Online ahead of print.ABSTRACTThe internal timekeeping system regulates the daily cycle of physiological and behavioural changes in living organisms. This rhythmic phenomenon also influences cellular responses to reactive oxygen species, such as hydrogen peroxide (H2O2). However, the interaction between H2O2 and fish mucosal cells is not well understood. This study examined the temporal variations of immunological and physiological responses to H2O2 in salmonid gill cells using the RTgill-W1 cell line. The results showed that gene expression levels varied during a 24-hour cycle but did not exhibit rhythmicity. The presence of a 12-hour light-dark cycle (12L:12D) signal increased gene expression levels compared to a 24-hour dark cycle (0L:24D). To investigate whether the time of day affects the defences in gills, cells were exposed to H2O2 at two different times (Zeitgeber time 2, ZT2, or ZT14). Although significant expression changes were observed in genes related to stress and NF-κB signalling, only a limited time-dependent pattern of response to H2O2 was observed. The intracellular metabolome of gill cells was primarily composed of organic acid and derivatives, organoheterocyclic compounds, benzoids, organic oxygen and nitrogen compounds. Exposure to H2O2 at ZT2 led to significant changes in the metabolome compared to the control group, while no such changes were observed at ZT14. Within the control groups, the concentrations of 11 metabolites significantly varied between ZT2 and ZT14, with higher levels at ZT14. These metabolites were involved in arginine biosynthesis, amino acid metabolism, and nitrogen metabolism. In contrast, the level of 26 metabolites significantly varied between ZT2 and ZT14 in H2O2-exposed groups, with lower levels at ZT14. Comparing control and H2O2-exposed groups at ZT2, 38 metabolites were affected, primarily organic acid and derivatives and organic oxygen compounds. Functional annotation revealed that these altered metabolites were involved in 15 different pathways, with valine, leucine, and isoleucine biosynthesis being the most affected. This study reveals the presence of a time-dependent response to H2O2 in salmonid gill cells, which is reflected in the intracellular metabolome. The findings provide new insights into the temporal regulation of mucosal defences in fish.PMID:39481503 | DOI:10.1016/j.fsi.2024.109994

Brain Behav Immun. 2024 Oct 29:S0889-1591(24)00674-3. doi: 10.1016/j.bbi.2024.10.032. Online ahead of print.ABSTRACTDespite significant effort, a clear understanding of host tissue-specific responses and their implications for immunopathogenicity against the severe acute respiratory syndrome coronavirus2 (SARS-CoV-2) variant infection has remained poorly defined. To shed light on the interaction between organs and specific SARS-CoV-2 variants, we sought to characterize the complex relationship among acute multisystem manifestations, dysbiosis of the gut microbiota, and the resulting implications for SARS-CoV-2 variant-specific immunopathogenesis in the Golden Syrian Hamster (GSH) model using multi-omics approaches. Our investigation revealed the presence of increased SARS-CoV-2 genomic RNA in diverse tissues of delta-infected GSH compared to the omicron variant. Multi-omics analyses uncovered distinctive metabolic responses between the delta and omicron variants, with the former demonstrating dysregulation in synaptic transmission proteins associated with neurocognitive disorders. Additionally, delta-infected GSH exhibited an altered fecal microbiota composition, marked by increased inflammation-associated taxa and reduced commensal bacteria compared to the omicron variant. These findings underscore the SARS-CoV-2-mediated tissue insult, characterized by modified host metabolites, neurological protein dysregulation, and gut dysbiosis, highlighting the compromised gut-lung-brain axis during acute infection.PMID:39481495 | DOI:10.1016/j.bbi.2024.10.032

Benef Microbes. 2024 Oct 29:1-13. doi: 10.1163/18762891-bja00046. Online ahead of print.ABSTRACTStress significantly affects gastrointestinal and mental health, and the gut microbiota plays a pivotal role in this process. Enterococcus faecalis strain EC-12 (EC-12) is a lactic acid bacterium that has several health benefits. To investigate the impact of oral supplementation with heat-killed EC-12 on the discomfort caused by stress, a randomised, double-blind, placebo-controlled trial was conducted with students under academic stress taking EC-12 (n = 14) or a placebo (n = 13) daily for one week. Improvement in the students' symptoms was assessed using the visual analogue scale. Faecal microbiota was characterised by next-generation sequencing of 16S rRNA genes, and faecal metabolites and short-chain fatty acids were analysed using a GC-MS metabolomics approach. Significant improvements in abdominal pain and rumbling of the stomach were found in the EC-12 group compared to the placebo group, but no changes were observed in mental symptoms or salivary cortisol levels. The relative abundance of E. faecalis significantly increased in the EC-12 group after the trial; however, the composition and diversity of the gut microbiota did not change significantly. Functional analysis of the gut microbiota suggested that EC-12 intake alters specific metabolic pathways. Although the levels of faecal short-chain fatty acids did not change between the groups before and after the trial, EC-12 intake altered the composition of faecal metabolites, with a significant increase in tryptamine levels. The ratio of students with improved symptoms to those with increased tryptamine levels was calculated based on the number of students with elevated faecal tryptamine levels who showed symptomatic improvements. The ratio of improved rumbling stomach was higher than that of other types of digestive discomfort. These results suggest that oral supplementation with EC-12 has a potentially beneficial effect on stress-induced gastrointestinal discomfort, which may occur through alterations in gut microbiota composition and metabolism. This study was registered at the University Hospital Medical Information Network Center (UMIN) under the UMIN ID: UMIN000048184.PMID:39481416 | DOI:10.1163/18762891-bja00046